[GMCEC19390-21]: Image contains multiple insects

[bioscan-browser]

Record details

Record ID

GMCEC19390-21

Images

Original full	Cropped full

Metadata

BIOSCAN-5M

{
    "id": "GMCEC19390-21",
    "latlon": "10.929,-85.464",
    "original_insect_pixels": 67365,
    "inferred_ranks": 0,
    "country": "Costa Rica",
    "sampleid": "BIOUG70617-A08",
    "province_state": "Guanacaste",
    "chunk": "c9",
    "split": "pretrain",
    "phylum": "Arthropoda",
    "processid": "GMCEC19390-21",
    "dna_barcode": "CTATATTTCATTTTTGGGGCATGATCTAGAATAGTTGGGACTTCCTTAAGAATATTGATTCGGGCTGAATTAGGATGTCCTAATGCATTGATTGGTGATGATCAAATCTACAATGTTATTGTTACTGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGGTTTGGAAATTGATTAGTTCCTTTAATATTGACGGCCCCTGATATGGCTTTCCCTCGTTTAAATAATATAAGATTTTGATTATTGCCTCCTTCTCTAACACTTTTATTAACAAGAAGTCTGGTAGAAAGGGGAACTGGGACGGGCTGAACTGTTTATCCTCCCTTGTCTAGTACCTTAAGACATTCTGGGGCTTCTGTAGACCTTTCTATTTTTTCTCTACATTTAGCTGGGATTTCTTCTATTCTAGGTGCAGTAAATTTTATTTCTACAATTATTAATATACGAACATATGGAATAAGATTTGATAAAATGCCTTTATTTGTATGATCAGTTTTTATTACTGCTGTCTTATTGTTACTATCGTTACCTGTATTAGCAGGGGCTATCACAATACTATTAACAGACCGAAATTTAAATACTTCTTTTTTTGACCCAATAGGAGGAGGGGATCCAATTTTATACCAACACTTATT",
    "dna_bin": "BOLD:ACV8865",
    "index_bioscan_1M_insect": "41511.0",
    "family": "Sciaridae",
    "class": "Insecta",
    "order": "Diptera",
    "updated": "2024-06-21T15:51:10.558Z",
    "timestamp": "2024-06-21T15:51:10.558Z",
    "cropped_bbox": "ENVELOPE(256.0,825.0,754.0,309.0)",
    "original_image_size": "1024,768",
    "cropped_area_fraction": 0.322,
    "cropped_scale_factor": 1.7383,
    "collectors": [
        "D.Janzen",
        "W.Hallwachs"
    ],
    "_version_": 1811931901174218800
}

BOLD

{
    "processid": "GMCEC19390-21",
    "sampleid": "BIOUG70617-A08",
    "fieldid": "GMP#25665",
    "museumid": "BIOUG70617-A08",
    "record_id": "GMCEC19390-21.COI-5P",
    "specimenid": 13363023,
    "processid_minted_date": "2021-05-31",
    "bin_uri": "BOLD:ACV8865",
    "bin_created_date": "2015-07-26",
    "collection_code": "BIOUG",
    "inst": "Centre for Biodiversity Genomics",
    "sovereign_inst": null,
    "taxid": 105275,
    "kingdom": "Animalia",
    "phylum": "Arthropoda",
    "class": "Insecta",
    "order": "Diptera",
    "family": "Sciaridae",
    "subfamily": null,
    "tribe": null,
    "genus": null,
    "species": null,
    "subspecies": null,
    "species_reference": null,
    "identification": "Sciaridae",
    "identification_method": "BOLD ID Engine",
    "identification_rank": "family",
    "identified_by": "BOLD Identification System [2022]",
    "identifier_email": null,
    "taxonomy_notes": null,
    "sex": " ",
    "reproduction": " ",
    "life_stage": null,
    "short_note": "Malaise trap Derrumbe-B",
    "notes": "Derrumbe-B",
    "voucher_type": "Vouchered:Registered Collection",
    "tissue_type": "inv whole voucher",
    "specimen_linkout": null,
    "associated_specimens": null,
    "associated_taxa": null,
    "collectors": "D.Janzen, W.Hallwachs",
    "collection_date_start": "2016-01-28",
    "collection_date_end": "2016-02-04",
    "collection_event_id": null,
    "collection_time": null,
    "collection_notes": null,
    "geoid": 504,
    "country/ocean": "Costa Rica",
    "country_iso": "CR",
    "province/state": "Guanacaste",
    "region": "Area de Conservacion Guanacaste",
    "sector": "Sector Cacao (Parque Nacional Guanacaste)",
    "site": "Derrumbe",
    "site_code": null,
    "coord": [
        10.929,
        -85.464
    ],
    "coord_accuracy": null,
    "coord_source": null,
    "elev": 1220,
    "elev_accuracy": null,
    "depth": null,
    "depth_accuracy": null,
    "realm": "Neotropic",
    "biome": null,
    "ecoregion": "Talamancan_montane_forests",
    "habitat": "1. Forest & Woodland | 1.9. Subtropical/Tropical Moist Montane Forest",
    "sampling_protocol": "Malaise Trap",
    "nuc": "CTATATTTCATTTTTGGGGCATGATCTAGAATAGTTGGGACTTCCTTAAGAATATTGATTCGGGCTGAATTAGGATGTCCTAATGCATTGATTGGTGATGATCAAATCTACAATGTTATTGTTACTGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGTGGGTTTGGAAATTGATTAGTTCCTTTAATATTGACGGCCCCTGATATGGCTTTCCCTCGTTTAAATAATATAAGATTTTGATTATTGCCTCCTTCTCTAACACTTTTATTAACAAGAAGTCTGGTAGAAAGGGGAACTGGGACGGGCTGAACTGTTTATCCTCCCTTGTCTAGTACCTTAAGACATTCTGGGGCTTCTGTAGACCTTTCTATTTTTTCTCTACATTTAGCTGGGATTTCTTCTATTCTAGGTGCAGTAAATTTTATTTCTACAATTATTAATATACGAACATATGGAATAAGATTTGATAAAATGCCTTTATTTGTATGATCAGTTTTTATTACTGCTGTCTTATTGTTACTATCGTTACCTGTATTAGCAGGGGCTATCACAATACTATTAACAGACCGAAATTTAAATACTTCTTTTTTTGACCCAATAGGAGGAGGGGATCCAATTTTATACCAACACTTATT",
    "nuc_basecount": 653,
    "insdc_acs": null,
    "funding_src": null,
    "marker_code": "COI-5P",
    "primers_forward": null,
    "primers_reverse": null,
    "sequence_run_site": "Centre for Biodiversity Genomics",
    "sequence_upload_date": "2021-10-18",
    "bold_recordset_code_arr": [
        "GMCEC"
    ],
    "collection_date_accuracy": -7,
    "geopol_denorm.country_iso3": "CRI",
    "marker_count": 1,
    "pre_md5hash": "0c4ea5b1090005015b4dcea7657d224f",
    "specimendetails.verbatim_identification_method": "Id Engine: Top Hits",
    "specimendetails.verbatim_sampling_protocol": "Malaise Trap",
    "count": 1
}

Links

• Record details (BIOSCAN Browser)
• Record details (BOLD Systems)
• Samples with same taxonomic label
• Samples with same DNA barcode

Report details

Report type

Image contains multiple insects

Comments

Discuss this with the CBG team during a live demo; they also believed that it was a multiple insect image.

Submitted by

Graham Taylor (@gwtaylor) from BIOSCAN Browser

[zahrag]

This is a good example of multiple insects.

[gwtaylor]

I did this during a live demo with the CBG Exec team so I got expert thumbs up when selecting this one. Credit to @scottclowe though for finding it originally!