Start position is a negative number

[Leo-ccc]

Hi!

my command:

perl concur.pl -i HD.Aligned.sortedByCoord.out.bam -g GRCh38 -o HD.codon.occ -n HD -r 5000

and encountered an error as follows:

Error: Invalid record in file /dev/fd/63. Record is
chrM -7 21 AE01231101005:9:4P240301014UY1S3242SX:L01:R001C060:0115:7938 CACGATGGATCACAGGTCTATCACCCTA -
Error: Invalid record in file /dev/fd/63. Record is
chrM -3 22 AE01231101005:9:4P240301074UY1S3256SX:L01:R004C037:0067:1228 ATGGATCACAGGTCTATCACCCTAT -
Error in dimnames(x) <- dn : length of 'dimnames' [2] not equal to array extent
Calls: colnames<-
stop
Error in xy.coords(x, y, xlabel, ylabel, log) :
'x' and 'y' lengths differ
Calls: plot -> plot.default -> xy.coords
stop

Meanwhile, the error I encountered resulted in a 'codons.txt' file that contains only 8 columns.

Thanks!

[susbo]

Apologies for the delay in response.

My guess would be that some reads are aligned to the very first bases of chrM, which makes the coordinates negative when using a window around the TIS. I would recommend excluding the mitochondrial genome when creating data/GRCh38.bed.gz, since you don't want to include these genes in your analysis and that will likely solve your issue.

Please let me know if anyone else is having similar problems.